vaRRI - Visualizing any RNA-RNA interaction

This Tool creates a visualization for any working inter- and intramolecular structure and sequence involving one or two molecules, using FornaC.

Example interaction between the molecule MicF and IpxR, displayed in this paper

Sequence 1 (blue/purple) is the MicF RNA and Sequence 2 (orange/red) is the IpxR RNA. The basepairs forming the interaction are highlighted using an opague red background. The color grading displays predicted accessibilty data starting at 1, completely accessible, to 0, not accessible.

./rna_to_img.py -o=example.svg \
  --sequence="GCCAGUAGCCUUGCUAUUUCAGUGGCGAAUGAUGAUGCAGGU&GCUAUCAUCAUUAACUUUAUUUAU" \
  --structure="...(((((............(((....(((((((((((....&)).))))))))).))))))))..." \
  --startIndex1=67 \
  --accessibility1="RNAplfold" --accessibility2="RNAplfold"

Overview

• vaRRI
• Overview
• Dependency Installation
• Features
  • Mandatory Parameters
  • Optional Parameters
  • Usage Examples

Dependency Installation

We need to install

• playwright (tested and developed with v1.57.0)
• chromium browser (install via playwright)

# install dependencies
python3 -m pip install playwright==1.57.0
python3 -m playwright install chromium
# check version
python3 -m playwright --version

For structure prediction and accessibility data prediction, vaRRI uses RNAplfold and RNAfold from the ViennaRNA package. Recommended installation using Miniconda

# setup bioconda
conda config --add channels defaults
conda config --add channels bioconda
conda config --add channels conda-forge
conda config --set channel_priority strict
# install viennaRNA package
conda install viennarna

Features

Mandatory Parameters

--structure Specifies the RNA secondary structure in dot-bracket notation.

Notation	Meaning
( )	Base pair
[ ]	Alternative bracket pair
< >	Alternative bracket pair
{ }	Alternative bracket pair
.	Unpaired nucleotide
&	Separator between two molecules (intermolecular interaction)

intramolecular: rna_to_img.py \ -u="((...))...." \ -e="NNNNNNNNNNN"
intermolecular: rna_to_img.py \ -u="((...))..<<..&...>>.." \ -e="NNNNNNNNNNNNN&NNNNNNN"

Hybrid Input Format (Advanced)

The hybrid input format provides a convenient way to specify intermolecular base pairing interactions using position indices instead of dot-bracket notation.

Format:

<start_pos_1><pipes_and_dots>&<start_pos_2><pipes_and_dots>

Where:

• <start_pos>: Starting position (index, can be negative, can not be 0)
• |: Represents a base pair in the intermolecular interaction
• .: Represents an unpaired position within the interaction region

How it works:

• Both molecules must have the same number of | characters (representing the same number of base pairs)
• Interaction positions are defined relative to your sequence start Index
• The tool automatically converts hybrid input to standard dot-bracket notation

Example (simple interaction): Two sequences with interaction starting at position 5 (seq1) and position 3 (seq2) and each has 3 intermolecular base pairs ./rna_to_img.py \ -u="5|||..&3|||.." \ -e="NNNNNNNNNNNNN&NNNNNNN"
Example (with custom start Index) Start indexing from position 10 (seq1) and 100 (seq2) Interaction starts at position 15 (seq1) and 102 (seq2) rna_to_img.py \ -u="15|||..&102|||.." \ -e="NNNNNNNNNNNNN&NNNNNNN" \ -i1=10 \ -i2=100
Example (negative positions): start indexing form -10 (seq1) and 1 (seq2) Interaction starts at position -5 (seq1) and 3 (seq2) rna_to_img.py \ -u="-5|||..&3|||.." \ -e="NNNNNNNNNNNNN&NNNNNNN" \ -i1=-10 \ -i2=1

Hybrid vs. Dot-Bracket Comparison: These two commands are equivalent:

Hybrid format: rna_to_img.py \ -u="5|||..&3|||" \ -e="NNNNNNNNNNNNNN&NNNNN"
Equivalent dot-bracket format: rna_to_img.py \ -u="....(((......&..))).." \ -e="NNNNNNNNNNNNN&NNNNNNN"

--sequence Specifies the RNA sequence using IUPAC nucleotide codes (see also --fastafile)

Code	Nucleotide	Code	Nucleotide
A	Adenosine	N	Any nucleotide
C	Cytidine	W	Adenosine or Uridine
G	Guanosine	S	Cytidine or Guanosine
U	Uridine	K	Guanosine or Uridine
		&	Separator between two molecules

Example: rna_to_img.py -u=".((...))." -e="AACGAGUGA"

Optional Parameters

-o/ --output Specifies the output file name and format

Value	Description
STDOUT (default)	Print SVG to standard output
filename	Save as SVG with given name
filename.png	Save as PNG with given name

Examples:

# Output to stdout
rna_to_img.py -u="((...))." -e="ACGAGUGA" > output.svg

# Save as SVG file
rna_to_img.py -u="((...))." -e="ACGAGUGA" -o=structure

# Save as PNG file
rna_to_img.py -u="((...))." -e="ACGAGUGA" -o=structure.png

-c/ --coloring Defines how nucleotides should be colored

Option	Description	Example
loop	Standard fornac coloring scheme
strand (default)	Each molecule receives its own color

Example: rna_to_img.py \ -u="((...))..<<..&...>>.." \ -e="NNNNNNNNNNNNN&NNNNNNN" \ -c=strand

-H/ --highlighting Specifies the highlighting mode for intermolecular structures

Option	Example Image
nothing: no sepcial highlighting rna_to_img.py \ -u="((...))..<<....<<..&..>>...>>.." \ -e="NNNNNNNNNNNNNNNNNNN&NNNNNNNNNNN" \ -H=nothing \ -c=loop
basepairs: Highlights only individual intermolecular base pairs rna_to_img.py \ -u="((...))..<<....<<..&..>>...>>.." \ -e="NNNNNNNNNNNNNNNNNNN&NNNNNNNNNNN" \ -H=basepairs
region(default): Highlights entire intermolecular interaction region rna_to_img.py \ -u="((...))..<<....<<..&..>>...>>.." \ -e="NNNNNNNNNNNNNNNNNNN&NNNNNNNNNNN" \ -H=region

-bH/ --backgroundhighlighting Specifies the background highlighting mode for intermolecular interactions

Option	Description
nothing	no background highlighting
basepairs (default)	highlights intermolecular basepair stacking
region	highlights the full intermolecular interaction region

rna_to_img.py \
  --structure="((...))..<<..&...>>.." \
  --sequence="NNNNNNNNNNNNN&NNNNNNN" \
  -bH=region

-i1/ --startIndex1, -i2/ --startIndex2 Sets the starting index for each molecule

Parameter	Constraint
Default	1
Restriction	Cannot be 0

Example: Indexing starts with 10 rna_to_img.py \ -u="..((...))." \ -e="AAACGAGUGA" \ -i1=10
Example: Both molecules have different start indicies rna_to_img.py \ -u="((...))..<<..&...>>.." \ -e="NNNNNNNNNNNNN&NNNNNNN" \ -i1=5 \ -i2=100

-v/ --verbose Enables detailed logging output for debugging and troubleshooting

./rna_to_img.py -u="((...))." -e="ACGAGUGA" -v

-l/ --labelInterval Defines how often labels with indices are displayed

Option	Description
n	Shows index labels every n nucleotides
10	default

rna_to_img.py \
  -u="((...))....((...))" \
  -e="ACGAGUGAACGAGUGA" \
  -l=5

--crop, --crop1, --crop2 Crops sequences around the intermolecular interaction region

Parameter	Description
--crop	Applies cropping to both molecules
--crop1	Crops only the first molecule
--crop2	Crops only the second molecule

rna_to_img.py \
  -u="((...))..<<..&...>>.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  --crop=5

--highlightSubseq1, --highlightSubseq2 Highlights specific subsequences

Parameter	Description
--highlightSubseq1	Subsequences in first molecule
--highlightSubseq2	Subsequences in second molecule

rna_to_img.py \
  -u="((...))..<<..&...>>.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  --highlightSubseq1="1:2,5:10"

--guBasepairs Controls visualization of G-U base pairs

Option	Description
Enabled (default)	G-U basepairs shown as dashed lines
Disabled	No special visualization

rna_to_img.py \
  -u="((...))" \
  -e="GUGUGUGU" \
  --guBasepairs

--fastafile Load one or two sequences from a FASTA file

rna_to_img.py \
  --fastafile=example.fasta \
  -u="((...))"

--predictStructure1, --predictStructure2 Enable intramolecular structure prediction

Flag Option	Description
Enabled	Predict intramolecular structure for each molecule. Using RNAfold with constraints: --structure given Basepairs
Disabled (default)	No structure prediction

rna_to_img.py \
  -e="ACGAGUGA" \
  --predictStructure1

--forcefield Activates fornac’s force-directed layout forcefield

rna_to_img.py \
  -u="((...))" \
  -e="ACGAGUGA" \
  --forcefield=0

--accessibility1, --accessibility2 Visualize nucleotide accessibility

Option	Description
None (default)	No visualization
RNAplfold	Predict accessibility using RNAplfold
path/to/file	Use precomputed lunp file

rna_to_img.py \
  -u="((...))" \
  -e="ACGAGUGA" \
  --accessibility1="RNAplfold"

--RNAfold Pass custom parameters to RNAfold

rna_to_img.py \
  -e="ACGAGUGA" \
  --predictStructure1 \
  --RNAfold="-T20"

--RNAplfold Pass custom parameters to RNAplfold

rna_to_img.py \
  -e="ACGAGUGA" \
  --accessibility1="RNAplfold" \
  --RNAplfold="-T20"

Usage Examples

Simple Intramolecular Structure Visualization of a single RNA molecule with one hairpin loop: rna_to_img.py -u=".((...))." -e="AACGAGUGA" > hairpin.svg
Intermolecular Interaction with Distinct Coloring Two molecules interacting where each molecule has its own color: rna_to_img.py \ -u="((...))..<<..&...>>.." \ -e="NNNNNNNNNNNNN&NNNNNNN" \ -c=strand \ -o=interaction.svg
Custom Indexing Start numbering from different positions for each molecule: rna_to_img.py \ -u="((...))..<<..&...>>.." \ -e="NNNNNNNNNNNNN&NNNNNNN" \ -i1=5 -i2=100 \ -o=custom_index.svg
Pseudoknot Structure (Simple) A basic pseudoknot involving two interacting molecules: rna_to_img.py \ -u="<<<..((..>>>&<<<..))..>>>" \ -e="NNNNNNNNNNN&NNNNNNNNNNNN" \ -c=strand \ -o=pseudoknot_simple.svg
Pseudoknot Structure (Complex - Kissing Hairpins) Two molecules forming a complex kissing hairpin interaction: rna_to_img.py \ -u="<<<..(((..>>>...<<<..(((..>>>..&<<<..)))..>>>...<<<..)))..>>>.." \ -e="NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN&NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN" \ -c=strand \ -o=kissing_hairpins.svg